Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Springer Berlin (Verlag)
978-3-642-74199-9 (ISBN)
Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . .
Why a Workshop on Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation.- Using Embryonal Stem Cells to Introduce Mutations into the Mouse Germ Line.- New Strategies in Developmental Biology: In Vivo Mutagenesis as a Tool to Dissect Mammalian Development.- Visualization by nlsLacZ of Gene Activity during Mouse Embryogenesis.- The Albino Perinatal Lethal Mutation: Identification of Affected mRNAs and Mapping of the Locus by Pulsed-Field Gel Electrophoresis.- Mutations in Transgenic Mice.- Effects of Provirus Insertion on Expression of ?1(I) Collagen Gene in Mov13 Mice.- Cellular Target Sequences for Retrovirus Integration.- Identification of Retroviral Sequences Involved in the Inactivation of the Viral Genome in Embryonal Carcinoma Cells.- Strand Switching during Retroviral Reverse Transcription.- Do Retroviuses Contribute to the Genesis of Intron-less Pseudogenes?.- Biological Activities of Mouse Retrotransposons MURRS/LTR-IS.- Retroviral Receptors and Interference on Human Cells.- Cell Targeting by Recombinant Retroviruses Using Bi-specific Antibody Complexes.- Improvement of Gene Expression and Virus Production in the Use of Retroviral Vectors for Gene Transfer.- New Retroviral Models for Gene Therapy: Swords into Plowshares.- Hemopoietic Regulation Assessed in Clonal Culture: A Brief Overview.- Haemopoietic Cells as Targets for Gene Transfer.- Human (3-globin Expression in Murine Bone Marrow Transplant Recipients Reconstituted with Retrovirally Transduced Stem Cells.- Genetic Manipulation of Human Hematopoietic Stem Cells.- The Role of Cytokines in the Normal and Abnormal Growth of Hemopoietic Cells.- Tumor Necrosis Factor and Interleukin-6: Structure and Mechanism of Action of the Molecular, Cellular and In Vivo Level.- UnexpectedBiological Effects of the Deregulated IL-2/IL-2 Receptor System on the Lymphocyte Development.- T Cell Activation Signals and Regulation of Lymphokine Gene by Viral and Cellular Transactivators.- Lymphoid VDJ Recombinase Activity: Development of a Novel Fluorescence- based Assay System.- Meiotic Copy Number Changes at CUPT are Mediated by Gene Conversion.- Epstein-Barr Virus Gene Expression in Normal and Malignant B Cells: Implications for the Immune T Cell Control of EBV Infection.- Suppression of Cellular Gene Activity in Adenovirus-transformed Cells.- Dysregulated Activation of a Haemopoietic Growth Factor Gene alone is Insufficient to Cause Malignent Haemopoietic Disease in Normal Haemopoietic Cells.- Mechanisms of IL-3 Regulated Growth and Transformation of Hematopoietic Cells.- Synergism between Oncogenes in T-cell Lymphogenesis.- The Mouse jun Family.- The c-jun Gene and Its Role in Signal Transduction.- Two Nuclear Oncogene Products Cooperate in the Formation of the Transcription Factor AP-1.- p53: Onco - or Anti-onco - Gene? A Critical Review.- Activation of the Cellular p53 Gene in Friend Virus-transformed Erythroleukemia Cell Lines.- Analysis of Transcriptional Regulatory Regions of the Human p53 Gene in Human Cells Using an EBV-derived Shuttle Vector.- SV40 DNA Replication In Vitro.- Contributors.- Acknowledgements.
| Erscheint lt. Verlag | 22.11.2011 |
|---|---|
| Reihe/Serie | Nato ASI Subseries H: |
| Zusatzinfo | VIII, 477 p. |
| Verlagsort | Berlin |
| Sprache | englisch |
| Maße | 170 x 242 mm |
| Gewicht | 833 g |
| Themenwelt | Medizin / Pharmazie ► Medizinische Fachgebiete ► Mikrobiologie / Infektologie / Reisemedizin |
| Naturwissenschaften ► Biologie ► Mikrobiologie / Immunologie | |
| Naturwissenschaften ► Biologie ► Zellbiologie | |
| Schlagworte | Antibody • Cell • cell differentiation • Cytokine • cytokines • Differenzierung • Gene • gene expression • gene therapy • Genetics • Genexpression • leukemia • molecular genetics • Oncogenes • Onkogene • Stem Cells • transcription • Vektoren • Virus • Wachstum |
| ISBN-10 | 3-642-74199-1 / 3642741991 |
| ISBN-13 | 978-3-642-74199-9 / 9783642741999 |
| Zustand | Neuware |
| Haben Sie eine Frage zum Produkt? |
aus dem Bereich
